ID: 1071719026_1071719034

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1071719026 1071719034
Species Human (GRCh38) Human (GRCh38)
Location 10:88124036-88124058 10:88124067-88124089
Sequence CCTGATAGGGTGGGGACCGAGCT AAACAGATGGAGTATGGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!