ID: 1071728104_1071728115

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1071728104 1071728115
Species Human (GRCh38) Human (GRCh38)
Location 10:88219891-88219913 10:88219914-88219936
Sequence CCCCTTCTGGGATCTGAGCCCAC CCTTCAGGGGAATCTCCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!