ID: 1071822542_1071822549 |
View in Genome Browser |
Spacer: -8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1071822542 | 1071822549 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:89293048-89293070 | 10:89293063-89293085 |
Sequence | CCCATAATCCTCATGTGTCAAGG | TGTCAAGGGCAGGACCTGATGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 9, 2: 62, 3: 493, 4: 1628} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |