ID: 1071835717_1071835729

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1071835717 1071835729
Species Human (GRCh38) Human (GRCh38)
Location 10:89415161-89415183 10:89415207-89415229
Sequence CCCGGAAGGCCTGTCCACCCATC AGCGGCGACGGTGACCGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!