ID: 1071856104_1071856112

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1071856104 1071856112
Species Human (GRCh38) Human (GRCh38)
Location 10:89626047-89626069 10:89626080-89626102
Sequence CCTTCTCCCCTTCATGCCTACAG TATTTCTGCTTCAGGGGTTAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!