ID: 1071858011_1071858016

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1071858011 1071858016
Species Human (GRCh38) Human (GRCh38)
Location 10:89645166-89645188 10:89645181-89645203
Sequence CCGGGGCTCCCGCCGCCCGCCTT CCCGCCTTCCCCTGATCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 370} {0: 1, 1: 0, 2: 0, 3: 39, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!