ID: 1071875332_1071875343

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1071875332 1071875343
Species Human (GRCh38) Human (GRCh38)
Location 10:89837785-89837807 10:89837831-89837853
Sequence CCGGTTGGGCCGCATTTCCGGGG CCGCGCGTACCTTGTCCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} {0: 1, 1: 1, 2: 0, 3: 0, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!