ID: 1071923156_1071923158

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1071923156 1071923158
Species Human (GRCh38) Human (GRCh38)
Location 10:90374390-90374412 10:90374410-90374432
Sequence CCAGGTCAGCCAGGCTCATTGTG GTGCTCATTGAAGCCATCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!