ID: 1071923157_1071923161

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1071923157 1071923161
Species Human (GRCh38) Human (GRCh38)
Location 10:90374399-90374421 10:90374413-90374435
Sequence CCAGGCTCATTGTGCTCATTGAA CTCATTGAAGCCATCCTTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!