ID: 1071944323_1071944324

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1071944323 1071944324
Species Human (GRCh38) Human (GRCh38)
Location 10:90624471-90624493 10:90624513-90624535
Sequence CCAATCTAGAACACATGGTATCA CTAAAACACATGTAGATTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 48, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!