ID: 1071962571_1071962578

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1071962571 1071962578
Species Human (GRCh38) Human (GRCh38)
Location 10:90821500-90821522 10:90821545-90821567
Sequence CCTTGCCACTGCAGGCTAAGGTG GAAAGGCAGTCTAGGTCACAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!