ID: 1072021861_1072021870

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1072021861 1072021870
Species Human (GRCh38) Human (GRCh38)
Location 10:91410409-91410431 10:91410429-91410451
Sequence CCGCCTGGCGCTCCCGCCGCCCG CCGGCCCGACATGAGTGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 374} {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!