ID: 1072025887_1072025896

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1072025887 1072025896
Species Human (GRCh38) Human (GRCh38)
Location 10:91456070-91456092 10:91456114-91456136
Sequence CCATATGAACTTTAAAGTAGTTT CCATTGGTAGCCTGATGGGGGGG
Strand - +
Off-target summary {0: 9824, 1: 5657, 2: 3549, 3: 2611, 4: 3020} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!