ID: 1072025888_1072025896

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1072025888 1072025896
Species Human (GRCh38) Human (GRCh38)
Location 10:91456096-91456118 10:91456114-91456136
Sequence CCAATTCTGTGAAGAAAGCCATT CCATTGGTAGCCTGATGGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 27, 3: 49, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!