ID: 1072122964_1072122973

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1072122964 1072122973
Species Human (GRCh38) Human (GRCh38)
Location 10:92420191-92420213 10:92420226-92420248
Sequence CCGATGGGACCAGGTACGCGCGG ACAGGTGCCAGCCCCAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 19} {0: 1, 1: 0, 2: 0, 3: 22, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!