ID: 1072151566_1072151574

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1072151566 1072151574
Species Human (GRCh38) Human (GRCh38)
Location 10:92689295-92689317 10:92689324-92689346
Sequence CCGCAGCACCTGAACTCCAGCCA TCCCGCCGGGCCGCAGCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 430} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!