ID: 1072188061_1072188074

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1072188061 1072188074
Species Human (GRCh38) Human (GRCh38)
Location 10:93060890-93060912 10:93060929-93060951
Sequence CCTTCTTCTATCCAAAGGGTGCT GGGAGGTGCCCCGCGGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176} {0: 1, 1: 1, 2: 1, 3: 22, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!