ID: 1072224499_1072224505

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1072224499 1072224505
Species Human (GRCh38) Human (GRCh38)
Location 10:93355958-93355980 10:93355984-93356006
Sequence CCTCCTACCTCCAGTCCAGGTTT AAACCCTGCTACTGAAAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!