ID: 1072253783_1072253794

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1072253783 1072253794
Species Human (GRCh38) Human (GRCh38)
Location 10:93601403-93601425 10:93601436-93601458
Sequence CCTCCAGGACAGCCTCGGGCACA CGCGCGGGGTGGCCTCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 230} {0: 1, 1: 0, 2: 3, 3: 18, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!