ID: 1072255941_1072255948

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1072255941 1072255948
Species Human (GRCh38) Human (GRCh38)
Location 10:93620400-93620422 10:93620453-93620475
Sequence CCTAAATAGGCCATAGCTCAGGT CATTCTATGCAGTCATAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!