ID: 1072283771_1072283779

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1072283771 1072283779
Species Human (GRCh38) Human (GRCh38)
Location 10:93894077-93894099 10:93894105-93894127
Sequence CCGGGCTGCCGCTAACGGACGAT CCCGGGCGCCACTGAGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17} {0: 1, 1: 0, 2: 3, 3: 14, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!