ID: 1072290484_1072290497

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1072290484 1072290497
Species Human (GRCh38) Human (GRCh38)
Location 10:93960406-93960428 10:93960452-93960474
Sequence CCATATGGTCATCGGTCTCCATG CTGGATGGATTCCATGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 3, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!