ID: 1072304113_1072304127

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1072304113 1072304127
Species Human (GRCh38) Human (GRCh38)
Location 10:94090486-94090508 10:94090535-94090557
Sequence CCTGTCCAAAGTTGTGTGGAAAG ATGGAAGGTGCGGGGTGTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!