ID: 1072311607_1072311614

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1072311607 1072311614
Species Human (GRCh38) Human (GRCh38)
Location 10:94161649-94161671 10:94161684-94161706
Sequence CCTTCTCCTGTCTGATTACCCTG AACACTATTTTGAATATGAGTGG
Strand - +
Off-target summary {0: 2, 1: 65, 2: 2951, 3: 4590, 4: 1491} {0: 1, 1: 75, 2: 8859, 3: 5430, 4: 4386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!