ID: 1072360467_1072360473

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1072360467 1072360473
Species Human (GRCh38) Human (GRCh38)
Location 10:94654141-94654163 10:94654189-94654211
Sequence CCTGCCATCTTCTGTAGACAATT GGACTGTTACTCGGCTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 221, 4: 349} {0: 1, 1: 3, 2: 174, 3: 155, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!