ID: 1072379526_1072379532

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1072379526 1072379532
Species Human (GRCh38) Human (GRCh38)
Location 10:94853275-94853297 10:94853320-94853342
Sequence CCTTCCTTCCTTTGTGCATAATG AGAGTTCCAGGAGGCCATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 287} {0: 2, 1: 0, 2: 5, 3: 23, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!