ID: 1072381228_1072381233

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1072381228 1072381233
Species Human (GRCh38) Human (GRCh38)
Location 10:94873049-94873071 10:94873073-94873095
Sequence CCCTCTCCCAGAGATCTGTGTTC CAGTGAAAGGAGAAGCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 272} {0: 1, 1: 0, 2: 8, 3: 69, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!