ID: 1072485350_1072485358

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1072485350 1072485358
Species Human (GRCh38) Human (GRCh38)
Location 10:95849450-95849472 10:95849476-95849498
Sequence CCCTCCAGGACCCCAGCAAGAGA TCTCCTAAGGTCACCTGGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!