ID: 1072485355_1072485358 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1072485355 | 1072485358 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:95849462-95849484 | 10:95849476-95849498 |
| Sequence | CCAGCAAGAGAGTTTCTCCTAAG | TCTCCTAAGGTCACCTGGCTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 3, 3: 26, 4: 212} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||