ID: 1072503733_1072503744

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1072503733 1072503744
Species Human (GRCh38) Human (GRCh38)
Location 10:96043887-96043909 10:96043925-96043947
Sequence CCCGACGTCCATGCGGAGACCCG TCACCCCCGGGCTTTGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!