ID: 1072522697_1072522703

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1072522697 1072522703
Species Human (GRCh38) Human (GRCh38)
Location 10:96242480-96242502 10:96242523-96242545
Sequence CCTCAGATCTGTGTGTGCCTGGC GTGACCAATAAATAGGTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!