ID: 1072536521_1072536523

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1072536521 1072536523
Species Human (GRCh38) Human (GRCh38)
Location 10:96368554-96368576 10:96368574-96368596
Sequence CCCATTTTTCACTTCAGGAAACT ACTGAGACTCAAGTTCTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 317, 4: 2850} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!