ID: 1072539095_1072539103

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1072539095 1072539103
Species Human (GRCh38) Human (GRCh38)
Location 10:96384821-96384843 10:96384855-96384877
Sequence CCCCAGCACACTGCTGCACCTGC CTCACCCTACCGTGTGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 516} {0: 1, 1: 0, 2: 0, 3: 13, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!