ID: 1072552114_1072552122

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1072552114 1072552122
Species Human (GRCh38) Human (GRCh38)
Location 10:96487008-96487030 10:96487061-96487083
Sequence CCTGCAGTCTTCGTATTGTTCAC CTTTTAAGCCAGAAAGACCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 82, 4: 577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!