ID: 1072591482_1072591493

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1072591482 1072591493
Species Human (GRCh38) Human (GRCh38)
Location 10:96832238-96832260 10:96832267-96832289
Sequence CCCGGGCGACGCGGCTGGGCGTG GCCGCGGCGGAGGCTGGGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 123, 4: 1241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!