ID: 1072591483_1072591493 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1072591483 | 1072591493 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:96832239-96832261 | 10:96832267-96832289 |
Sequence | CCGGGCGACGCGGCTGGGCGTGC | GCCGCGGCGGAGGCTGGGCCGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 1, 2: 9, 3: 123, 4: 1241} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |