ID: 1072633819_1072633833

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1072633819 1072633833
Species Human (GRCh38) Human (GRCh38)
Location 10:97164757-97164779 10:97164780-97164802
Sequence CCCTGCCCAGGACTGCCGTGGCA TTGCCAGGGGTGGGGTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 247} {0: 1, 1: 2, 2: 16, 3: 187, 4: 1618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!