ID: 1072722914_1072722916

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1072722914 1072722916
Species Human (GRCh38) Human (GRCh38)
Location 10:97791932-97791954 10:97791947-97791969
Sequence CCAAGTGATGGTGCTGCTTTGCC GCTTTGCCAGCCCTGTAGGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!