ID: 1072772092_1072772094

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1072772092 1072772094
Species Human (GRCh38) Human (GRCh38)
Location 10:98150688-98150710 10:98150702-98150724
Sequence CCCAGGTGACTTGTGGAATGAAC GGAATGAACCTCCTACAGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 14, 3: 22, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!