ID: 1072780994_1072780997

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1072780994 1072780997
Species Human (GRCh38) Human (GRCh38)
Location 10:98251702-98251724 10:98251715-98251737
Sequence CCTGTAAGGAAGGGGACAGACAG GGACAGACAGGTTTTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 217} {0: 1, 1: 0, 2: 3, 3: 17, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!