ID: 1072798080_1072798082

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1072798080 1072798082
Species Human (GRCh38) Human (GRCh38)
Location 10:98371961-98371983 10:98371986-98372008
Sequence CCACACTCGAGGTGTTAGGAGAG ACACTTCCTCTGAAACCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 48, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!