ID: 1072804887_1072804899

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1072804887 1072804899
Species Human (GRCh38) Human (GRCh38)
Location 10:98418010-98418032 10:98418047-98418069
Sequence CCGTCCTCCCTCGCTGCACACAG GTGTTCCCAGCGTGGATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 47, 4: 398} {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!