ID: 1072809222_1072809224

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1072809222 1072809224
Species Human (GRCh38) Human (GRCh38)
Location 10:98446531-98446553 10:98446552-98446574
Sequence CCTGAGTCTCTGGAGAGAGCGAG AGTCAGCAGTTCGCCGCCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!