ID: 1072814262_1072814273

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1072814262 1072814273
Species Human (GRCh38) Human (GRCh38)
Location 10:98489226-98489248 10:98489269-98489291
Sequence CCATATTTGGCCAGATGGATTTT CTGATTATAGTTTTCCCTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 246} {0: 1, 1: 0, 2: 2, 3: 22, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!