ID: 1072816555_1072816558

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1072816555 1072816558
Species Human (GRCh38) Human (GRCh38)
Location 10:98515100-98515122 10:98515125-98515147
Sequence CCAGGGAATCTGAAAGCTGGGTG GTGGTCAAGCCGACTGAGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!