ID: 1072825045_1072825055

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1072825045 1072825055
Species Human (GRCh38) Human (GRCh38)
Location 10:98598450-98598472 10:98598490-98598512
Sequence CCTGTATCCATGACAGCCAGTCT GGTTGACCTGGTGCTGGTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 28, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!