ID: 1072831853_1072831856

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1072831853 1072831856
Species Human (GRCh38) Human (GRCh38)
Location 10:98666319-98666341 10:98666357-98666379
Sequence CCACACAGTAATAGCAGGGGACT CAGTGTTAGATCATTGAGGCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 50, 3: 290, 4: 2127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!