ID: 1072938917_1072938918

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1072938917 1072938918
Species Human (GRCh38) Human (GRCh38)
Location 10:99741572-99741594 10:99741588-99741610
Sequence CCTTTTTTTCTTTTGACAGGGTC CAGGGTCTCACCTGTTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 58, 3: 308, 4: 1319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!