ID: 1072946173_1072946177

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1072946173 1072946177
Species Human (GRCh38) Human (GRCh38)
Location 10:99811825-99811847 10:99811855-99811877
Sequence CCATGAATATCCAGCTGTGATCC ACATTTGTGTGTGCAGATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 110, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!