ID: 1072985011_1072985017

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1072985011 1072985017
Species Human (GRCh38) Human (GRCh38)
Location 10:100131741-100131763 10:100131759-100131781
Sequence CCCTCCACACCCTAGTGTGTCAG GTCAGTGTGAAGTGCGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!